deletions | additions       diff --git a/section_Methods_subsection_Bacterial_Strains__.tex b/section_Methods_subsection_Bacterial_Strains__.tex  index b6357f6..2406f03 100644  --- a/section_Methods_subsection_Bacterial_Strains__.tex  +++ b/section_Methods_subsection_Bacterial_Strains__.tex 
...
\textbf{Need Joe and Jason (and others in their labs, if applicable) to edit this section.}  The wild type Francisella tularensis LVS strain, along with the ΔdsbA and ΔdipA mutants, were provided by Jason Huntley (University of Toledo). The ΔiglC and ΔdeoB mutants were provided by Joseph Horzempa (West Liberty University). Deletion mutants were constructed using the pJH1/pGUTS system. A deletion plasmid was created using the pJH1 backbone and mobilized into F. tularensis LVS via conjugation. Exoconjugates were transformed with pGUTS using electroporation and screened for deletion of target gene. Lastly, pGUTS was cured from the deletion mutant to create the completed deletion mutants.  An \textit{iglC}-null mutation was conducted as previously described (REF 1). Codons 71-140 of both copies of \textit{iglC} were deleted sequentially. The entire open reading frame was not deleted to preserve elements presumed to be required for expression of neighboring genes (REF 2). A 0.5 kb region of the \textit{F. tularensis} LVS chromosome consisting of DNA upstream of \textit{iglC} and a portion of the N-terminal coding sequence as was amplified using primer 1 (CATGGCATGCTAAGATTGGTAGTATTGTGGATGTCGAGTCG) and primer 2 (GTCGACGGTACCACCGGTTTATTATTAACTAGCAGCAGCTGTAGCCG). An additional region of the \textit{F. tularensis} LVS chromosome consisting of the C-terminal coding sequence of \textit{iglC} as well as downstream DNA was amplified using primer 3 (TAATAATAAACCGGTGGTACCGTCGACCTATCTAATTTAGAGTTATATCCAATAAGTGC) and primer 4 (CATGCTGCAGCTTATCAGTCATTATTTGTAAAGATAACGG). The two 0.5 kb amplicons were cloned into pJH1(REF 1) adjacent to each other to generate pJH1ΔiglC. This plasmid was mobilized into \textit{F. tularensis} LVS using triparental mating as we have done previously (REF 1, 3). Isolated merodiploids were electroporated with pGUTS to force resolution (REF 1). Deletion of a single \textit{iglC} allele was confirmed by PCR (data not shown). After a strain was isolated in which a single copy of \textit{iglC} was deleted, pGUTS was cured as previously described (REF 1), and pJH1ΔiglC was subsequently re-introduced by triparental mating. PCR was used to confirm the recombination of this plasmid into DNA neighboring the intact \textit{iglC} allele (data not shown). Again, pGUTS was introduced into isolated merodiploids by electroporation (REF 1). Deletion of the second \textit{iglC} allele was confirmed by PCR and western blotting (data not shown). Subsequently, pGUTS was cured as was described previously (REF 1,3). The resulting \textit{iglC}-null mutant strain is referred to as ΔiglC.  1. Horzempa J., et al. 2010. Utilization of an unstable plasmid and the I-SceI endonuclease to generate routine markerless deletion mutants in Francisella tularensis. J. Microbiol. Methods 80:106–108  2. Lai, et al., 2004 Expression of IglC is necessary for intracellular growth and induction of apoptosis in murine macrophages by Francisella tularensis. Microb. Pathog.37:225-30.  3. Horzempa J. et al., 2010. Francisella tularensis ΔpyrF mutants show that replication in nonmacrophages is sufficient for pathogenesis in vivo. Infect Immun. 78: 2607–2619.  \subsection{Bacterial Growth Conditions}  \textit{Francisella tularensis} LVS deletion mutants were maintained as permanent frozen stocks at -80°C in BHI broth supplemented with 15\% glucose. E.coli DH5α was also maintained as a stock at -80°C in LB broth supplemented with 15\% glucose. Francisella mutants were grown on Chocolate II agar plates (GC base with 1\% isovitalex and 1\% Hemoglobin). For insect infections, Francisella colonies were grown at 37°C for 48 hours. E.coli DH5α was grown in LB broth or agar at 37°C for 20 hours.  
...