deletions | additions       diff --git a/section_Methods_subsection_Bacterial_Strains__.tex b/section_Methods_subsection_Bacterial_Strains__.tex  index fb56239..4a40199 100644  --- a/section_Methods_subsection_Bacterial_Strains__.tex  +++ b/section_Methods_subsection_Bacterial_Strains__.tex 
...
\section{Methods}  \subsection{Bacterial Strains and Knockout Construction }  \textbf{Need Joe and Jason (and others in their labs, if applicable) to edit this section.}  The wild type Francisella tularensis LVS strain, along with the ΔdsbA and ΔdipA mutants, were provided by Jason Huntley (University of Toledo). The ΔiglC and ΔdeoB mutants were provided by Joseph Horzempa (West Liberty University). Deletion mutants were constructed using the pJH1/pGUTS system. A deletion plasmid was created using the pJH1 backbone and mobilized into F. tularensis LVS via conjugation. Exoconjugates were transformed with pGUTS using electroporation and screened for deletion of target gene. Lastly, pGUTS was cured from the deletion mutant to create the completed deletion mutants.  Construction of the \textit{F. tularensis} LVS ΔdeoB \textit{ΔdeoB}  mutant was previously described in REF: Horzempa et al., J Microbiol Methods. 2010 Jan; 80(1): 106–108. An \textit{iglC}-null mutation was conducted as previously described (REF 1). Codons 71-140 of both copies of \textit{iglC} were deleted sequentially. The entire open reading frame was not deleted to preserve elements presumed to be required for expression of neighboring genes (REF 2). A 0.5 kb region of the \textit{F. tularensis} LVS chromosome consisting of DNA upstream of \textit{iglC} and a portion of the N-terminal coding sequence as was amplified using primer 1 (CATGGCATGCTAAGATTGGTAGTATTGTGGATGTCGAGTCG) and primer 2 (GTCGACGGTACCACCGGTTTATTATTAACTAGCAGCAGCTGTAGCCG). An additional region of the \textit{F. tularensis} LVS chromosome consisting of the C-terminal coding sequence of \textit{iglC} as well as downstream DNA was amplified using primer 3 (TAATAATAAACCGGTGGTACCGTCGACCTATCTAATTTAGAGTTATATCCAATAAGTGC) and primer 4 (CATGCTGCAGCTTATCAGTCATTATTTGTAAAGATAACGG). The two 0.5 kb amplicons were cloned into pJH1(REF 1) adjacent to each other to generate pJH1ΔiglC. This plasmid was mobilized into \textit{F. tularensis} LVS using triparental mating as we have done previously (REF 1, 3). Isolated merodiploids were electroporated with pGUTS to force resolution (REF 1). Deletion of a single \textit{iglC} allele was confirmed by PCR (data not shown). After a strain was isolated in which a single copy of \textit{iglC} was deleted, pGUTS was cured as previously described (REF 1), and pJH1ΔiglC was subsequently re-introduced by triparental mating. PCR was used to confirm the recombination of this plasmid into DNA neighboring the intact \textit{iglC} allele (data not shown). Again, pGUTS was introduced into isolated merodiploids by electroporation (REF 1). Deletion of the second \textit{iglC} allele was confirmed by PCR and western blotting (data not shown). Subsequently, pGUTS was cured as was described previously (REF 1,3). The resulting \textit{iglC}-null mutant strain is referred to as ΔiglC. 
...