deletions | additions       diff --git a/O_lurida.md b/O_lurida.md  index a0ad575..ac13227 100644  --- a/O_lurida.md  +++ b/O_lurida.md 
...
Olympia oyster sequencing efforts have spawned from studies examining the influence of ocean acidification and a study examining local adaptation in Puget Sound. As of March 2014 the libraries constructed and sequence include the following  | ID | Stage | Notes[^1]|  ------------ |------------  | ------------- | ------------ |  |Ol-larv 400_1 | larvae | 0112; 012159; 36SE|  |Ol-larv 2000_1 | larvae | 0112; 012159; 36SE|  |Ol-larv 400_2 | larvae | 0812; 103939; 36SE| 
...
[^1]: Date, HTGUorder, seq  Libraries Ol-larv 400_1 and Ol-larv 2000_1 were described as part of the publication:   **Timmins-Schiffman, E. B., Friedman, C. S., Metzger, D. C., White, S. J. and Roberts, S. B. (2013), Genomic resource development for shellfish of conservation concern. Molecular Ecology Resources, 13: 295–305. doi: 10.1111/1755-0998.12052**  >Larvae were transferred to the University of Washington 12 h post spawning. Larvae (12 larvae/mL) were evenly distributed to six 4.5-L larval chambers. Larvae were sampled from all chambers by filtering them onto a 35 μm screen and flash freezing in liquid N2 on days one, two and three post-fertilization. Two RNA-seq libraries (Ol-larv 400_1 and Ol-larv 2000_1) were constructed from pooled mRNA (13 μg per sample).  Raw data is available at   NCBI: http://www.ncbi.nlm.nih.gov/sra/SRX175407  ---  In order to characterize the reproductive transcriptome of the Olympia oyster four libraries were made in from pooled gonad samples. The ideas were 106A_Female, 106A_Male, 108A_Female, 108A_Female.    diff --git a/V_tubiashii.md b/V_tubiashii.md  index e6f39b0..77222ed 100644  --- a/V_tubiashii.md  +++ b/V_tubiashii.md 
...
#_Vibrio tubiashii_  According to the our records the first library we every ever  sequenced was from  *Vibrio tubiashi*. Don't know much about it it, but  we call called  it 'mRNA' and the facility tube labeling indicated "Vibrio(our writing)  Lib 1/23/09 DB 7.82ng/uL 200bp". Download Link: http://eagle.fish.washington.edu/trilobite/meadow/Vt_sol_09.fa  As part of a Saltonstahl Kennedy funded project entitled "insert name" genomic libraries were generated and sequenced. Two different strains were partially sequenced in an effort to learn what genetic differences might be associated with different phenotypes (growth) under ocean acidification conditions. ```  !head   >SOLEXA-1GA-2_2_FC30DHC:5:1:918:97  ATCCTCCAAGGCTAAATACTACTGACTGACCGATAG  >SOLEXA-1GA-2_2_FC30DHC:5:1:832:119  AACGCTTACACACCCTGCCTATCAACGTTCTAGTCT  >SOLEXA-1GA-2_2_FC30DHC:5:1:784:1521  GCCGAACTCAGAAGTGAAACGCAATAGCGCCGATGG  >SOLEXA-1GA-2_2_FC30DHC:5:1:943:93  ATTCGCTATCCTTGCCGATTGTTCATCCTGAGCAAC  >SOLEXA-1GA-2_2_FC30DHC:5:1:959:98  ACGATCCCTAGCTGGTCTGAGAAGATGATCAGCCAC  ```  ---  As part of a Saltonstall-Kennedy Grant funded project entitled "_Ocean acidification and emerging diseases in the Pacific Northwest_" genomic libraries were generated and sequenced. Two different strains were partially sequenced in an effort to learn what genetic differences might be associated with different phenotypes (ie growth) under ocean acidification conditions.  The next occurance of this taxa was not until years later with two genomic DNA libraries: RE22 and XXXXX? These were SOLiD libraries sequenced in early 2011. This effort was part of the thesis work of Elene Dorfmeier. The thesis, "_Ocean acidification and disease: How will a changing climate impact Vibrio tubiashii growth and pathogenicity to Pacific oyster larvae?_" is [available online](https://digital.lib.washington.edu/researchworks/bitstream/handle/1773/20742/Dorfmeier_washington_0250O_10226.pdf?sequence=1) A detailed description of her work with respect to these libaries can be found in her thesis . Page-- Raw data is available in SRA?? and a lot of secondary analysis files are available via figshare.     dorfmeier, elene (2012): * Contiguous sequences from Vibrio tubiashii ATCC19106 assembly  http://dx.doi.org/10.6084/m9.figshare.90804  * Vibrio tubiashii ATCC19106 annotated contiguous sequences  http://dx.doi.org/10.6084/m9.figshare.91173  *  Vibrio tubiashii ATCC19106 virulence associated contiguous sequences. figshare. sequences  http://dx.doi.org/10.6084/m9.figshare.91933 * Contiguous sequences from Vibrio tubiashii RE22 assembly  http://dx.doi.org/10.6084/m9.figshare.90805  * Vibrio tubiashii RE22 annotated contiguous sequences  http://dx.doi.org/10.6084/m9.figshare.91172  * Vibrio tubiashii RE22 virulence associated contiguous sequences  http://dx.doi.org/10.6084/m9.figshare.91171