deletions | additions       diff --git a/abstract.tex b/abstract.tex  index e428ea6..8e27213 100644  --- a/abstract.tex  +++ b/abstract.tex 
...
As the shear sheer  volume of bioinformatic sequence data increases the only way to take advantage of this content is to more completely automate robust analysis workflows. Analysis bottlenecks are often mundane and overlooked processing steps. Idiosyncrasies in reading and/or writing bioinformatics file formats can halt or impair analysis workflows by interfering with the transfer of data from one informatics tools to another. Fasta-O-Matic automates handling of common but minor format issues that otherwise may halt pipelines. The need for automation must be balanced by the need for manual confirmation that any formatting error is actually minor rather than indicative of a corrupt data file. To that end Fasta-O-Matic reports any issues detected to the user with optionally color coded and quiet or verbose logs. Fasta-O-Matic can be used as a general pre-processing tool in bioinformatics workflows (e.g. to automatically wrap FASTA files so that they can be read by BioPerl). It was also developed as a sanity check for bioinformatic core facilities that tend to repeat common analysis steps on FASTA files received from disparate sources. Fasta-O-Matic can be set with format requirements specific to downstream tools as a first step in a larger analysis workflow. 
...
        diff --git a/acknowledgements.tex b/acknowledgements.tex  index f1082ae..cf4cf45 100644  --- a/acknowledgements.tex  +++ b/acknowledgements.tex 
...
\section{Acknowledgements}  Thanks to Sheldon McKay https://github.com/mckays630 for contributing to  the editing of Fast-O-Matic. This project was supported by an Institutional Development Award (IDeA) from the National Institute of General Medical Sciences of the National Institutes of Health under grant number P20 GM103418. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of General Medical Sciences or the National Institutes of Health. diff --git a/implementation.tex b/implementation.tex  index 4861887..4453079 100644  --- a/implementation.tex  +++ b/implementation.tex 
...
Inconsistent or unwrapped sequence lines, spaces in headers and missing or non-standard new lines are considered non-fatal errors. Testing for these issues is optional. If they are detected the decision is made to reformat as requested, report the issue to the analyst and continue the workflow.  Testing the uniqueness of the header/description line can return a non-fatal warning and a reformatted file or a fatal error. Testing for uniqueness is optional. If the first word in each header/description line is unique then it follows that all description lines are unique. If the first words are not unique then it is possible that is because the header ids include whitespace \verb|>seq 1| or \verb|> seq 1|. In this case a resolution is to replace the whitespace with a character. Fasta-O-Matic replaces the whitespace with \verb|_| and retests for the uniqueness of the first words in the headers. If this version passes than the user is warned that whitespace effected header uniqueness and was removed from headers. If removing whitespace also fails to resolve the issue the lack of uniqueness is considered a fatal error. The fatal error is reported and the program halts.  The script also automatically adjusts to run the minimal number of steps sufficient to fix and report format issues. If it is included in the set of QC steps then wrapping is the first format issue tested because while repairing FASTA wrapping both headers and new lines can be corrected. New lines are given priority after wrapping because while repairing new lines it is also trivial to repair headers. Next, uniqueness of the header lines is tested.  Finally, headers are evaluated for format issues. white space.  If an early test returns a format issue and launches a reformatting that automatically repairs any remaining format issues then Fasta-O-Matic still tests for any additional format errors in the original file. All format issues are reported in the programs logs in case they indicate an unexpected issue with the data. Logs can be optionally color coded so that red indicates errors, yellow indicates warnings (e.g. a non-fatal issue was found and automatically reformatted) and green indicates status information. This method of logging is designed to draw the attention of the bioinformatics analyst to relevant warnings or errors even if they have grown accustomed to seeing Fasta-O-Matic output frequently.   
...
  Sequence FASTA files are often passed as arguments to commandline tools. For example FASTA files can be passed as an argument to bowtie2-build to be indexed as an alignment reference \cite{langmead2012fast} or passed to trimmomatic as adapters to detect sequencing artifacts. The output filename used by Fast-O-Matic varies to reflect the reformatting performed. For seamless integration into automated workflows Fasta-O-Matic returns the full path of the new properly formatted FASTA file or the original file (if it is already formatted properly). This can be captured as a variable and used as an argument in subsequent commands. The Bash commands below show and example of capturing the FASTA file name as a variable.  Code :  \begin{verbatim}  filename="$(python fasta_o_matic.py -f NC_010473_mock_scaffolds.fna -o ~/out_fasta_o_matic -c)"  echo $filename  \end{verbatim} diff --git a/introduction.tex b/introduction.tex  index 26ee681..6783517 100644  --- a/introduction.tex  +++ b/introduction.tex 
...
use Bio::SeqIO;  use Bio::DB::Fasta; #makes a searchable db from FASTA file  my $out_file_temp = '/home/bionano/test_db/all.fa';  #Create new FASTA outfile object  my $seq_out = Bio::SeqIO->new('-file' => ">$out_file_temp",'-format' => 'fasta');#Create new   #FASTA outfile object  my $db = Bio::DB::Fasta->new("/home/bionano/test_db/miswrapped.fa");#Load 'fasta');  #Load  FASTA file as DB my $db = Bio::DB::Fasta->new("/home/bionano/test_db/miswrapped.fa");  my $seq_obj = $db->get_Seq_by_id('seq'); # get FASTA records using headers   #(where header = first 'word' so really header whitespace should also be removed #removed  for this file) $seq_out->write_seq($seq_obj);  \end{verbatim} 
...
Output:  \begin{verbatim}  ------------- EXCEPTION -------------  MSG: Each line of the fasta entry must be the same length except the last. Line above #5 'CTAGAGCGCAGCTCTGGGGG..' is 61 != 86 chars... \end{verbatim}  EMBOSS seqret was designed as a very flexible tool to convert from one properly formatted file to another properly but distinctly formatted file. It also was designed to accept poorly formatted data (e.g. a FASTA missing the final new line that is improperly wrapped) and export a reformatted file (e.g. wrapped after 60 bases with a final newline). 
...
The process of restarting analysis manually after wrapping a FASTA file may only take minutes. The time consuming aspect of this interruption is the time it takes the analyst to become available and the number of jobs this step must be repeated for. Likewise, storage of one extra FASTA file is trivial unless the FASTA file in question stores a whole genome in which case the burden can add up for a bioinformatics core. Efficiency and automation are crucial as bioinformatic analysis projects become more numerous and time consuming. Many tools can either detect a format issue or repair a format issue. No existing tool was found that both validates FASTA format and reformats automatically only where required for a user defined list of non-fatal FASTA format issues.        diff --git a/results.tex b/results.tex  index 075c95d..bb12449 100644  --- a/results.tex  +++ b/results.tex 
...
\subsection{Data}  FASTA format tools were tested on the Vicugna\_pacos-2.0.1 whole genome shotgun sequence scaffolds because the 2.17 Gb \textit{Vicugna pacos} genome is large (> ($>$  1 Gb) and has many scaffolds (276727) \cite{Lindblad_Toh_2011}. The large genome size and high number of individual sequences should approximate a typical large FASTA file. The FASTA file was downloaded from the NCBI FTP as NW\_005882702.1 \textit{Vicugna pacos} isolate Carlotta (AHFN-0088) Vicugna\_pacos-2.0.1 assembly scaffolds. An additional unwrapped sequence was added to the end of the file. This sequence was also missing a newline. Each FASTA record in the file also had spaces within the text of the headers.  Additional simulated FASTA record: 
...
\subsection{Comparison between results}  All tools could reformat the improperly wrapped FASTA file. Fasta-O-Matic had the lowest maximum memory requirements (Figure 1, Table 1). This may be useful if working on a large genome on a local machine or cluster headnode where memory usage is restricted. Fasta-O-Matic took several minutes rather than seconds (seqtk and seqret took <13 $<$ 13  s) (Figure 2, Table 1). Fully re-formatted simulated FASTA record: record (backslashes are used to indicate a new line that is for display in the article rather than the new lines being included in the actual FASTA record):  \begin{verbatim}  >NW_000000000.0_Vicugna_pacos_isolate_Carlotta_(AHFN-0088)_FAKE_genomic_scaffold,_Vicugna_pacos-2.0.1_Scaffold-,_whole_genome_shotgun_sequence >NW_000000000.0_Vicugna_pacos_isolate_Carlotta_(AHFN-0088)_FAKE_genomic_scaffold,_Vicugna_pacos-2.1_Scaffold-,_whole_genome_shotgun_sequence  ATACAACCATAAAGGTGCTATTCAGTCCATGGTTACAGGACATAACTACAACACACACCC  ACGTACACATGCGCATGCGCATGCACACACCCACGTACACGTACACGTACGCATACACAC  CCACGTACACGTACACGTACGCATACACACCCACGTACACGTACACGTACGCATACACAC 
...
        diff --git a/simulated_unwrapped.fa b/simulated_unwrapped.fa  new file mode 100644  index 0000000..5983259  --- /dev/null  +++ b/simulated_unwrapped.fa 
...
>NW_000000000.0 Vicugna pacos isolate Carlotta (AHFN-0088) FAKE genomic scaffold, Vicugna_pacos-2.0.1 Scaffold-, whole genome shotgun sequence   ATACAACCATAAAGGTGCTATTCAGTCCATGGTTACAGGACATAACTACAACACACACCCACGTACACATGCGCATGCGCATGCACACACCCACGTACACGTACACGTACGCATACACACCCACGTACACGTACACGTACGCATACACACCCACGTACACGTACACGTACGCATACACACCCACGTACACGTACACGTACGCATACACACCCACGTACACGTACACGTACGCATACACACCCACGTACGCACACACGTACACGTGTAGGCACGCATTTAGCAAGTATTTAGCTTGCTTAAACAAACCCCCCCTACCCCCCACGAGCCCCACCTTATATACCAGACAGTCTTGCCAAACCCCAAAAACAAGACATAGCGCATAAGCTATAGAACCCGGACAAACCTTTGCCCACAAACCCAACTTCTTAAATAATCACATGGCCAAATCGTACCAATGTGTTACTCTAGTATATTAAAAATATACAGACAGCTATCTCCCTAGATCCGCCAAAATTTTTAAAACAGAATTCAACAACCTTTTTAATGGCACCCCCCCCCCCCATAAATGACC