deletions | additions       diff --git a/Materials and Methods.tex b/Materials and Methods.tex  index daad7c5..1a3a19c 100644  --- a/Materials and Methods.tex  +++ b/Materials and Methods.tex 
...
5,260,610 76bp paired-end reads (Illumina MiSeq) of an unknown textit{Yersinia} were provided to us in fastq format. Data quality was assessed using a combination of FASTQC and the Fastx-toolkit. All quality metrics indicated the data was of high quality (Figure 1). We did detect a carried over Illumina adapter sequence 'GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGATCGGAAGAGCACACG' which was removed using the fastx-clipper.  Interleved forward and reverse reads were assembled using Velvet (v1.2.09). The VelvetOptimiser script was used to select the optimal kmer length (optimal kmer =53) and to determine coverage threshold (optimal cov_cutoff=1.96) optimized for 'n50'. The largest assembled contig was 563,205bp, and there were 40 contigs greater than 1kbp with an average length of 118,677bp. The total length of all contigs was 4,747,089bp, with and n50 of 276703; this is consistent with other Yersinea genome sizes (?? - ??). An AMOS bank (.bnk) file was generated from the AMOS file (.afg) generated by Velvet using the bank-transact function. Our assembly was validated using Amosvalidate, followed by visual inspection in Hawkeye (Figure 2). The ResFinder server was used to identify antibiotic resistance genes in assembled contigs\cite{22782487}.