deletions | additions       diff --git a/Material and Methods.tex b/Material and Methods.tex  index b0bffc5..b4c8774 100644  --- a/Material and Methods.tex  +++ b/Material and Methods.tex 
...
DNA extraction For plankton, cells were collected by filtering between 20 – 30 mL of water onto a 0.2 $\mu$m pore-size polycarbonate filter. For biofilm communities, biomass from the entire coverslip area of three separate slides were collected and combined in an eppendorf tube by gentle scrapping the slip surface with an ethanol rinsed and flamed razor blade. DNA was extracted using a Mobio Power Soil DNA isolation kit.   \subsubsection{PCR}  Samples were amplified for pyrosequencing using a forward and reverse fusion primer. The forward primer was constructed with (5’-3’) the Roche A linker (CCATCTCATCCCTGCGTGTCTCCGACTCAG), an 8-10bp barcode, and the XXXXXXXX primer ([citation for forward gene specific primer]). The reverse fusion primer was constructed with (5’-3’) a biotin molecule, the Roche B linker (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), and the XXXXXXX primer ([citation for reverse gene specific primer]). Amplifications were performed in 25 ul reactions with Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California), 1ul of each 5uM primer, and 1ul of template. Reactions were performed on ABI Veriti thermocyclers (Applied Biosytems, Carlsbad, California) under the following thermal profile: 95○C 95$^{\circ}$C  for 5 min, then 35 cycles of 94○C 94$^{\circ}$C  for 30 sec, 54○C for 40 sec, 72○C 72$^{\circ}$C  for 1 min, followed by one cycle of 72○C 72$^{\circ}$C  for 10 min and 4○C 4$^{\circ}$C  hold. Amplification products were visualized with eGels (Life Technologies, Grand Island, New York). Products were then pooled equimolar and each pool was cleaned with Diffinity RapidTip (Diffinity Genomics, West Henrietta, New York), and size selected using Agencourt AMPure XP (BeckmanCoulter, Indianapolis, Indiana) following Roche 454 protocols (454 Life Sciences, Branford, Connecticut). Size selected pools were then quantified and 150 ng of DNA were hybridized to Dynabeads M-270 (Life Technologies) to create single stranded DNA following Roche 454 protocols (454 Life Sciences). Single stranded DNA was diluted and used in emPCR reactions, which were performed and subsequently enriched. Sequencing following established manufacture protocols (454 Life Sciences).