this is for holding javascript data
Ed Hall edited Material and Methods.tex
almost 10 years ago
Commit id: 5a0f298ee6e153d46a3b305a7fae9c0f6f792e12
deletions | additions
diff --git a/Material and Methods.tex b/Material and Methods.tex
index 4678dd4..b0bffc5 100644
--- a/Material and Methods.tex
+++ b/Material and Methods.tex
...
DNA extraction For plankton, cells were collected by filtering between 20 – 30 mL of water onto a 0.2 $\mu$m pore-size polycarbonate filter. For biofilm communities, biomass from the entire coverslip area of three separate slides were collected and combined in an eppendorf tube by gentle scrapping the slip surface with an ethanol rinsed and flamed razor blade. DNA was extracted using a Mobio Power Soil DNA isolation kit.
\subsubsection{PCR}
The 16S rRNA gene was Samples were amplified
for pyrosequencing using
bacterial specific primers that targeted the ??? region of the SSU rRNA gene. The specific primers used were 5'-GAGTTTGATCNTGGCTCAG-3' (28F ???) and 5'-GTNTTACNGCGGCKGCTG-3' (519R ???), respectively. Each primer included a
barcode forward and
adapter sequence for 454 amplicon sequencing on the FLX-Ti platform (Roche). reverse fusion primer. The
PCR program for 16S amplification forward primer was
as follows: NEED TO TRACK THIS DOWN. To assess the diversity of constructed with (5’-3’) the
algal comuunity, the 23S region of Roche A linker (CCATCTCATCCCTGCGTGTCTCCGACTCAG), an 8-10bp barcode, and the
plastid genome was targeted (REF). The XXXXXXXX primer ([citation for forward gene specific
primer]). The reverse fusion primer
pair used was
NAME constructed with (5’-3’) a biotin molecule, the Roche B linker (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), and
NAME (5'-GGACAGAAAGACCCTATGAA-3' the XXXXXXX primer ([citation for reverse gene specific primer]). Amplifications were performed in 25 ul reactions with Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California), 1ul of each 5uM primer, and
5'-TCAGCCTGTTATCCCTAGAG-3', respectively) (REF). The plastid genome 23S sequence has proved to yield reliable phylogenies 1ul of template. Reactions were performed on ABI Veriti thermocyclers (Applied Biosytems, Carlsbad, California) under the following thermal profile: 95○C for
algae (REF).
The PCR program 5 min, then 35 cycles of 94○C for 30 sec, 54○C for
amplification 40 sec, 72○C for 1 min, followed by one cycle of
plastid 23S sequences was as follows: NEED TO TRACK THIS DOWN.
PCR 72○C for 10 min and 4○C hold.
Amplification products were
visualized with eGels (Life Technologies, Grand Island, New York). Products were then pooled
in equimass amounts. Mass equimolar and each pool was
determined cleaned with Diffinity RapidTip (Diffinity Genomics, West Henrietta, New York), and size selected using
???. Multiplexed PCR product Agencourt AMPure XP (BeckmanCoulter, Indianapolis, Indiana) following Roche 454 protocols (454 Life Sciences, Branford, Connecticut). Size selected pools were
sequenced at the Research then quantified and 150 ng of DNA were hybridized to Dynabeads M-270 (Life Technologies) to create single stranded DNA following Roche 454 protocols (454 Life Sciences). Single stranded DNA was diluted and used in emPCR reactions, which were performed and
Testing subsequently enriched. Sequencing
Facility (Lubbock, Texas, USA). following established manufacture protocols (454 Life Sciences).
best guess at primer sequence
blue104F GGC GVA CGG GTG AGT AA
blue530R CCG CNG CNG CTG GCA C
Algae-F GGACAGAAAGACCCTATGAA
Algae-R TCAGCCTGTTATCCCTAGAG
another option for reverse primers
Our Algae reverse sequence is CCTGTTATCCCTAGAG
The 16S reverse is CCGCNGCNGCTGGCAC