Kyunghwa Jeong added Generation_of_knock_in_alleles__.tex  almost 9 years ago

Commit id: 4d79f6bd7956980894a7a440af2c3ac9abc4f584

deletions | additions      

         

Generation of knock-in alleles  Knock-in alleles were generated by targeted site-specific DNA integration.   5’ and 3’ homologous arms were PCR amplified using \emph{w\textsuperscript{1118}} genomic DNA with primer sets (5’- CGAGATGAATTCTAGCCTCATCAACTGAGC-3’ and 5’- CGAGATGCGGCCGCGAGCAAGCACTAATAGCA  -3’ for 5arm; 5’-GAGATACTAGTCATGCTACAATGTCAGCA-3 and 5’-CGAGATCTCGAGGGCCACGTATAGGGATGC-3’ for 3arm) and inserted into pGX-attP vector (DGRC #1293).   P{Donor} flies were generated by P-element based transgenesis of cloned \emph{pGX-attP} vector into fly genome (Genetic Services, Inc., US) and crossed with Flp I-Sce I flies for homologous recombination.   Candidate targeting lines with red eye or mosaic eyes are selected and verified by PCR.   Verified line was white marker-removed by Cre recombination and used as founder line (\emph{DmCa\textsubscript{v}3\textsuperscript{Founder,w-}}) for site-specific DNA integration.  \emph{DmCa\textsubscript{v}3\textsuperscript{Gal4}}, \emph{DmCa\textsubscript{v}3\textsuperscript{Rescue}} and \emph{GFP::DmCa\textsubscript{v}3} lines were generated by $\phi$C31 integrase based site-specific integration.   Gal4 construct (Splicing acceptor-Gal4 CDS-poly A) was amplified from \emph{pBS-KS-attB1-2-GT-SA-GAL4-Hsp70pA} vector (DGRC #1325) with primer set (5’-CGTACTCCACGAATTTCTAGAAGTCGATCCAACAT-3’ and 5’-ACCGGCGCGCCTCGACTCTAGAACTAGTGGATCTA-3’).   Amplified DNA fragment were sequenced and inserted into \emph{pGE-attB\textsuperscript{GMR}} vector (DGRC #1295) using EZ-FusionTM cloning kit (Enzynomics).   Rescue construct were PCR amplified using \emph{w\textsuperscript{1118}} genomic DNA as template with primer set (5’-gcaGAATTCAATCGATTCCATAGATCCGC-3’ and 5’-GCACTCGAGAATTTTGCAACAGGCAGCTA-3’) and inserted into \emph{pGE-attB\textsuperscript{GMR}} vector at EcoR I/Xho I site.   GFP containing fragment and (GlyGlySer)4 linker were amplified from \emph{pBS-KS-attB1-2-PT-SA-SD-1-EGFP-FIAsH-StrepII-TEV-3xFlag} vector (DGRC #1306) with primer set (5’-GCACCCCAGAAAATGGTGTCCAAGGGCGAGGAGCT-3’ and 5’-CGCTGGCTGTGGCAGGGAACCTCCGCTTCCACCGC-3’).   Amplified fragment was then inserted into 3’ downstream of ATG translation start site in Rescue construct by inverse PCR (5’-CTGCCACAGCCAGCGGCAGCG-3’ and 5’-CATTTTCTGGGGTGCCAACTA-3’) using 5X In-Fusion HD Enzyme Premix (Clontech).   \emph{pGE-attB\textsuperscript{GMR}} vectors containing each of Gal4, Rescue and GFP tagging constructs were injected into \emph{DmCa\textsubscript{v}3\textsuperscript{Founder,w-}} embryo (Rainbow Transgenic Flies, Inc., US) for $\phi$C31 mediated site-specific integration of each constructs into \emph{attP} site in DmCa\textsubscript{v}3 locus. \emph{DmCa\textsubscript{v}3\textsuperscript{Gal4}} and \emph{DmCa\textsubscript{v}3\textsuperscript{Rescue}} were white marker-removed for further behavior analysis.