2.2 DNA extraction, PCR amplification and sequencing
The total DNA of L. spadiceus was extracted from each muscle following the FastPure Cell/Tissue DNA Isolation Mini Kit (Nanjing, China). The purity and concentration of DNA were checked using ultra microspectrophotometer (NanoDrop 2000, United States of America). The primers of mtDNA were adapted from Li et al (Li et al., 2018). TheCOI was boosted by the primers COI- F: 5’-AAACCACCGCCTGACACTC-3’ and COI- R: 5’-GGGATTTTAACCCCCGGCAT-3’, the Cyt b was boosted by the primers Cyt b -F: 5’- GCGCCCCAAAGTAAGGAGAA-3’ and Cyt b -R: 5’- GGGATTTTAACCCCCGGCAT -3’. PCR amplification volume of 50 µl, including 25 µl 2×Taq PCR Master Mix, 2 µl each of primers (10µ mol/L), 1 µl DNA template, and 20 µl ddH2O. PCR cycling conditions were applied: initial denaturation at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 1 min (COI ) or 30 sec (Cytb ), annealing at 58 °C (COI ) or 56 °C (Cyt b ) for 1 min, extension at 72 °C for 1 min, and final elongation at 72 °C for 8 min (COI ) or 5 min (Cyt b ). Every PCR product was electrophoresed on 1% agarose gel, and PCR products were sent to Guangzhou Ige Biotechnology Ltd (Guangzhou, China) for purification and DNA sequencing.