2.6.2 High throughput analysis of AM fungi
Total DNA was extracted from mixed soil (0.5 g) using Fast DNA® Spin Kit
for Soil. And then AM fungus-specific primers AML1 and AML2 were
selected as the first round of primers ((Lee, Lee , & Young, 2008),
AMV4.5NF (AAGCTCGTAGTTGAATTTCG) and AMDGR (CCCAACTATCCCTAT-TAATCAT) were
selected as the second round of primers for amplification with the
nested PCR amplification method ((Sato, Suyama, Saito , & Sugawara,
2005). The PCR amplification products were detected and recovered by 2%
agarose gel electrophoresis, and Illumina’s MiseqPE300 platform was used
for sequencing. Raw sequences were uploaded to the NCBI Sequence Read
Archive (SRP426700).