Strain construction
All derivatives of the USA300 agr/sae mutants were obtained by transduction of specific mutations from the Nebraska mutant library (Fey et al., 2013) into strain USA300 agr/sae using Φ11 lysates. All mutants were confirmed by PCR using oligonucleotides spanning the transposon insertion sites. For expression of sodM inS. epidermidis , sodM was amplified using oligonucleotides 5’‑CCAGTGAATTCGAGCTCAAATTATATTAAGTTATATTATTTTGCTGCTTGGT-3 and 5’‑ATGATGGTACCGTTAACAACACACCCGAAATTAATTATT-3. The construct was cloned into the AHT-inducible vector pCG248. The generated plasmid pCG817 was transduced into S. epidermidis 1457 using S. aureus PS187 Δsau ΔhsdR and the phage Φ187.Transductants were verified with 5’-CAAAATTATACATGTCAACGA-3’ and 5’‑AAGCAGCTCTAATGCGCTGT-3’