Evaluation of virus infection
Grafted plants were subjected to successive growth cycles in the
greenhouse and artificial winter in a cold chamber. After two months at
7 ºC in the cold chamber, plants were transferred to the greenhouse.
After eight weeks, plants were evaluated for sharka symptoms, and leaf
samples were taken for immunochromatographic (IC) test and RT-PCR.
Symptoms of sharka on the apricot leaves were evaluated from 0 to 5
based on the presence of chlorotic areas. For IC, the AgriStrip test
(Maejima et al. , 2014) was used following manufacturer
recommendations.
For RT-PCR, 100 mg of young leaves from each plant were collected,
quickly frozen in liquid nitrogen, and maintained at -80ºC until use.
Plant RNA extraction was performed using the commercial ”NucleoSpin® RNA
Plant and Fungi” (Machery-Nagel, Düren, Germany), following manufacturer
instructions. 1.5 µg of RNA (the volume depends on RNA concentration)
was mixed with 1 µl 10 mM oligo-dT primers (final volume 15 µl), and
heated at 70 ºC for 5 minutes, then 10 µl of the buffer M-MLV 5x
containing retro transcriptase and dNTPs was added, and the mixture was
heated for one hour at 42 ºC. First-strand cDNA was used as the template
in PCR reactions to amplify a 313 bases pair-fragment of the PPV capsid
gene using primers VP337 (CAATAAAGCCATTGTTGGATC) and VP338
(CTCTGTGTCCTCTTCTTGTG) (Martínez-Gómez et al. , 2003) in a final
volume of 25 µl containing 12.5 µl of GoTaq® Green Master Mix buffer
(Promega). Thermocycling was performed using a 2 min heating step at 94
°C followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C
for 30 s, followed by a final extension of 10 min at 72 ºC.
Northern blot for small interference RNAs
For siRNA analysis, total RNA was extracted from transgenic and
untransformed leaves with the Tri® Reagent (Sigma-Aldrich Co., St.
Louis, Mo, USA), following manufacturers’ directions. Samples equivalent
to 20 µg of total RNA, as evaluated by Nanodrop® analysis (NJ1000
Nanodrop Technology Inc., Wilmington, DE, USA), were dissolved in 50%
formamide and, after heat-treatment, were loaded onto a denaturing
polyacrylamide gel (17,5%). After electrophoresis, the nucleic acids
were electro-blotted to a positively charged nylon membrane (Roche
Applied Science, Mannheim, Germany). Hybridization was performed in Dig
Easy Hyb buffer (Roche Applied Science, Mannheim, Germany) using a
DIG-labeled RNA probe corresponding to the PPV sequence present in the
h-UTR/P1 construct (Di Nicola-Negri et al. , 2005). For siRNAs
detection, membranes were treated with anti-DIG antibody-alkaline
phosphatase and CDP-Star (Roche Applied Science, Mannheim, Germany) and
exposed to X-ray films.