3.2. Genome size, organization, and ORFs
The libraries were prepared from the isolated DNA sample by Truseq Nano
DNA Library preparation kit. The number of filtered reads obtained was
24,657,026 out of which 1,241,516 reads were mapped to LSDV-NI2490
strain with 99.9% coverage using the CLC genomics workbench. The
average size of libraries was 442 bp, whereas the average coverage depth
was ~2500 X. After reference mapping and denovo assembly
and calling the consensus from the resultant BAM file, the full-length
genome size of LSDV-WB/IND/19 was 150,969 bp with a 145,938 bp central
coding region flanked by two inverted terminal repeats (ITRs) of 2613 bp
and 2418 bp. The genome has a high
A+T content of 74.1% and a compact gene arrangement with no large
regions of non-coding sequence as noted previously (Tulman et al., 2001;
Biswas et al., 2020). The putative concatemer resolution sequence (CRS)
element (5′‐ ATTTATAGGCTAAAAAAAAAGTA‐3′) was present at nt positions
86-108 which is a highly conserved sequence necessary for concatemer
resolution during genome replication. A total of 156 ORFs were annotated
as putative genes and numbered from left to right as previously
described (Tulman et al., 2001; Biswas et al., 2020). Four genes each,
viz. LSD_001 and LSD_156, LSD_002 and LSD_155, LSD_003 and
LSD_154, and LSD_004 and LSD_153 are identical and appear twice due
to their location within the ITRs. Like other LSDVs, LSDV-WB/IND/19
encodes nine genes (LSD_002, LSD_004, LSD_009, LSD_013, LSD_026,
LSD_126, LSD_132, LSD_153, LSD_155) that have been disrupted by
accumulated mutations in GTPV and SPPV. Although, the total sequence
length remains largely unchanged among capripoxviruses. Two short open
reading frames located between genes 28/29 and120/121, encoding 49‐a.a.
and 41‐a.a. proteins, respectively were numbered LSD_028.5 and
LSD_120.5 as described previously (Biswas et al., 2020).