2.2 DNA and solution preparation
Two DNA fragments were prepared with lengths 302 bp and 560 bp. For 560
bp DNA, target DNA containing I1-spacer-I2 was inserted into
plasmid pUC57 (Genscript). The half-sites were surrounded by 8 bp and 90
bp of wild-type sequence. Polymerase chain reaction (PCR) was used to
amplify a 560-bp region containing the half-sites using primers
gacggtgaaaacctctgacac (left), located within the plasmid, and
ggacaactccagtgaaaagttcttc (right), located within the insert. The
midpoint of I1-spacer-I2 (38 bp in length) was located 411 bp
from the left end and 149 bp from the right end, i.e., about 27% of the
total DNA length from the right end (Figure 1). For 302 bp DNA,I1-spacer-I2 was surrounded by 55 bp and 90 bp of wild-type
sequence. PCR was used to amplify a 302 bp region containing the
half-sites using primers cacggcagaaaagtccac (left) and tatgtagcatcaccttc
(right). The midpoint of I1-spacer-I2 was located 74 bp from the
left end and 228 bp from the right end, i.e. about 25% of the total DNA
length from the left end. The full sequences of the 302 bp and 560 bp
DNA fragments, plasmid, insert, template DNA, and PCR conditions are
shown in Figure S1.
The PCR product was spin-purified with the Qiagen PCR Purification kit
and resuspended in 10 mM Tris-Cl, pH 8.5. The purity and concentration
of the resulting purified DNA was determined by electrophoresis on 2%
agarose gels and comparison of ethidium bromide fluorescence of the
fragment to known amounts of similar sized DNA using a Low DNA Mass
Ladder (Invitrogen). Purified DNA stock solution (170 nM) was used for
all experiments.
DNA-only samples (Sample A) consisted of ~65 nM DNA,
~4 mM Tris-Cl 100 mM NaCl for 560 bp DNA (or 100 mM KCl
for 302 bp DNA), 2 mM MgCl2, and 10 mM HEPES. AraC/DNA
samples (Sample B) contained ~50 nM DNA,
~3 mM Tris-Cl, 470 nM AraC, 560 µM arabinose, 89 mM NaCl
(or KCl), 1.7 mM MgCl2, 8.5 mM HEPES, 100 µM
Na3PO4, and 0.5 µM NaN3.
DNA and Tris-Cl concentrations could be varied. DNA-only and AraC/DNA
samples were prepared immediately before deposition onto mica.
Attachment buffer consisted of 10 mM HEPES pH7.5 and 4.03 mM
MgCl2.