DNA extraction
Genomic DNA was extracted from peripheral blood of the proband using DNA extraction kits and standard protocols (TSP201-50, Tsingke, China).
Sanger sequencing
For analysis of UBE2A splice site mutation, the intron-based exon specific primers were designed with Primer 5 (primer-F: TGGGCCCAGTTTCTTAAGGA; primer-R: AATCAGGAGGCTCCCAGACT). The primers were used for amplify UBE2A exons. PCR was amplified with FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with DNA Gel Extraction Kit ( GE0101-50, Tsingke, China) following standard protocols. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).