2.2. pre-LASSO probes
The pre-LASSO probes were 158-bp long. The E.coli pre-LASSO probe
library was purchased as ssDNA oligo pool from Twist Bioscience. The
positive control pre-LASSO 1kbM13 was obtained from IDT ad as dDNA
(gBlock). The DNA sequences of pre-LASSO 1kbM13 is available in
(Supplementary Table 2 ). The ssDNA Twist oligo pool (20 ng) was
PCR amplified using selector primers Sap1F and BamH1R. The PCR was
performed in a 25µl of 1X Kapa Hi Fidelity Buffer with pre-LASSO probe
library (4ng), dNTPS (0.3 mM) and 0.5 units of Kapa Taq DNA polymerase,
and Selector primers (0.3 µM) aF. The PCR thermal cycle was 3min at
95°C, ( 98°C for 20 sec, 58°C for 15 sec, 1 min at 72°C) for 8 cycles.
The correct size of the amplicon (~160bp) was verified
by loading 3 µl of the PCR volume on a 2% agarose gel with ethidium
bromide and using Low Molecular Weight Ladder as reference . For the
single pre-LASSO probe 1kbM13 and for the 3,108 E. coli K12 ORF
pre-LASSO library subpool, the design was: 5´
CAGACGACGGCCAGTGTCGAC,Ligation Arm,
AACACTTCTTGCGGCGATGGTTCCTGGCTCTTCGATC, Extension Arm,
GGATCCTACGGTCATTCAGC 3´
The ORFs of the E. coli K12 genome that were longer than 400 nucleotides
were targeted with ligation and extension arms positioned at the
beginning and end of the sequences, respectively, and extended until the
desired melting temperature was reached. Specifically, the algorithm
first selected the ORFs leading and trailing 32-nucleotide sequences for
the two arms at melting temperatures for the ligation and extension arms
of between 65 °C and 85 °C and 55 °C and 80 °C, respectively. If at
least one of these conditions were not satisfied, the algorithm
increased the length of the arms by one nucleotide and re-tested the
conditions until they were satisfied or until the end of the ORF was
reached. Because probes had non-homogeneous lengths (depending on the Tm
of ligation and extension arms) up to a maximum length of 158bp, we
extended all probes to 158bp by adding random oligonucleotides in
between the primer selector annealing site and the extension arm.
Since a SwaI digestion step was used to assemble the LASSO probes, the
algorithm discarded the design of pre-LASSO probes where a Swa1
restriction site was present in the ligation or extension arm. A full
list of the 3089 ORFs with valid ligation and extension arms and their
corresponding pre-LASSO probes is reported in the Supplementary
Table 2 .