2.7 | Construction and detection of luciferase reporter of mouse PPARγ2 promoter
There are two NFAT binding (TTTTCC) sites in the human PPARγ2 promoter (distal -299 to -294 bp and proximal -146 to -141 bp) to fully regulate its expression in adipocytes (Kim et al., 2010) and hepatoma cells (Yang et al., 2003). However, these two NFAT binding sites haven’t been reported in mouse PPARγ2 promoter. We compared the sequence of mouse and human PPARγ2 promoters from -2000 to +45 bp and found that there were two potential NFAT binding sites in mouse PPARγ2 promoter, of which -395 to -390 bp (TTTTCT) was homologous to human distal NFAT site, and -238 to -233 bp (TTTTCC) was homologous to human proximal NFAT site. These two NFAT binding sites also covered the NF-κB binding sequence (TTTCC). Mouse liver genomic DNA was extracted as template to amplify the promoter sequence of PPARγ2 from -630 to +45 bp that contains the putative NFAT/NF-κB binding sites and its 5’- untranslated region (GenBank, AY243584.1) with forward primer (5’AGAACATTTCTCTATCGATAGGTACC TAGAATTTGGATAGCAGTAAC3’) containing Kpn I digestion site and reverse primer containing Hind III digestion site (5’ACCAACAGTACCGGAATGCCAAGCTT AACAGCATAAAACAGAGATTTG3’).
The amplified DNA fragments were digested by Kpn I (BioLabs, Cat# R0142S) and Hind III (BioLabs, Cat# R0104S), and purified. The pLG4.19 basic plasmid vector (Promega, Cat# E6741) containing firefly luciferase sequence was digested with Kpn I and Hind III to obtain the linearized vector. A PPARγ2-pLG4.19 plasmid containing mouse PPARγ2 promoter (-630 to +45 bp) and firefly luciferase was obtained by mixing purified PPARγ2 promoter fragment, linearized pLG4.19 and assembly reagent (TransGene Biotech, Cat# CU101) for 15 min at 50 °C. PCR and sequencing confirmed that the PPARγ2-pLG4.19 firefly luciferase plasmid was constructed correctly. Large scale amplification of PPARγ2-pLG4.19 plasmid was carried out in TransT1 Escherichia coli. For mouse PPARγ2 promoter activity assay, 1 μg PPARγ2-pLG4.19 firefly luciferase and 100 ng pRL-TK renilla luciferase plasmid control (Promega, Cat# E2241) were co-transfected into SMCs (8 × 105 cells per 60 mm dish) using SuperFect Transfection Reagent (Qiagen, Germany, Cat# 301305) as per manufacturer’s recommendations. Luciferase activities were measured using the Dual-Luciferase reporter assay kit (Beyotime Biotechnology, Cat# RG027) 72 hr after transfection. The ratio of firefly to renilla luciferase luminescence was calculated as indicative of PPARγ2 promoter activity. In some experiments, SMCs were treated cyclosporin A (CsA, 1 μM) or PDTC (10 μM) for 24 hr before measuring the activity of PPARγ2 promoter.