2.7 | Construction and detection of luciferase reporter
of mouse PPARγ2 promoter
There are two NFAT binding (TTTTCC) sites in the human PPARγ2 promoter
(distal -299 to -294 bp and proximal -146 to -141 bp) to fully regulate
its expression in adipocytes (Kim et al., 2010) and hepatoma cells (Yang
et al., 2003). However, these two NFAT binding sites haven’t been
reported in mouse PPARγ2 promoter. We compared the sequence of mouse and
human PPARγ2 promoters from -2000 to +45 bp and found that there were
two potential NFAT binding sites in mouse PPARγ2 promoter, of which -395
to -390 bp (TTTTCT) was homologous to human distal NFAT site, and -238
to -233 bp (TTTTCC) was homologous to human proximal NFAT site. These
two NFAT binding sites also covered the NF-κB binding sequence (TTTCC).
Mouse liver genomic DNA was extracted as template to amplify the
promoter sequence of PPARγ2 from -630 to +45 bp that contains the
putative NFAT/NF-κB binding sites and its 5’- untranslated region
(GenBank, AY243584.1) with forward primer
(5’AGAACATTTCTCTATCGATAGGTACC TAGAATTTGGATAGCAGTAAC3’) containing
Kpn I digestion site and reverse primer containing Hind III digestion
site (5’ACCAACAGTACCGGAATGCCAAGCTT AACAGCATAAAACAGAGATTTG3’).
The amplified DNA fragments were digested by Kpn I (BioLabs, Cat#
R0142S) and Hind III (BioLabs, Cat# R0104S), and purified. The pLG4.19
basic plasmid vector (Promega, Cat# E6741) containing firefly
luciferase sequence was digested with Kpn I and Hind III to obtain the
linearized vector. A PPARγ2-pLG4.19 plasmid containing mouse PPARγ2
promoter (-630 to +45 bp) and firefly luciferase was obtained by mixing
purified PPARγ2 promoter fragment, linearized pLG4.19 and assembly
reagent (TransGene Biotech, Cat# CU101) for 15 min at 50 °C. PCR and
sequencing confirmed that the PPARγ2-pLG4.19 firefly luciferase plasmid
was constructed correctly. Large scale amplification of PPARγ2-pLG4.19
plasmid was carried out in TransT1 Escherichia coli. For mouse PPARγ2
promoter activity assay, 1 μg
PPARγ2-pLG4.19 firefly luciferase
and 100 ng pRL-TK renilla luciferase plasmid control (Promega, Cat#
E2241) were co-transfected into SMCs (8 × 105 cells
per 60 mm dish) using SuperFect Transfection Reagent (Qiagen, Germany,
Cat# 301305) as per manufacturer’s recommendations. Luciferase
activities were measured using the Dual-Luciferase reporter assay kit
(Beyotime Biotechnology, Cat# RG027) 72 hr after transfection. The
ratio of firefly to renilla luciferase luminescence was calculated as
indicative of PPARγ2 promoter activity. In some experiments, SMCs were
treated cyclosporin A (CsA, 1 μM) or PDTC (10 μM) for 24 hr before
measuring the activity of PPARγ2 promoter.