This is pdfTeX, Version 3.14159265-2.6-1.40.15 (TeX Live 2014) (preloaded format=pdflatex 2014.5.25) 21 AUG 2015 15:07 entering extended mode restricted \write18 enabled. %&-line parsing enabled. **bmc_article.tex (./bmc_article.tex LaTeX2e <2014/05/01> Babel <3.9k> and hyphenation patterns for 78 languages loaded. (./bmcart.cls Document Class: bmcart 2014/01/24BioMed Central class (VS) (/usr/local/texlive/2014/texmf-dist/tex/latex/base/article.cls Document Class: article 2007/10/19 v1.4h Standard LaTeX document class (/usr/local/texlive/2014/texmf-dist/tex/latex/base/size10.clo File: size10.clo 2007/10/19 v1.4h Standard LaTeX file (size option) ) \c@part=\count79 \c@section=\count80 \c@subsection=\count81 \c@subsubsection=\count82 \c@paragraph=\count83 \c@subparagraph=\count84 \c@figure=\count85 \c@table=\count86 \abovecaptionskip=\skip41 \belowcaptionskip=\skip42 \bibindent=\dimen102 ) \mathindent=\dimen103 (/usr/local/texlive/2014/texmf-dist/tex/latex/graphics/keyval.sty Package: keyval 2014/05/08 v1.15 key=value parser (DPC) \KV@toks@=\toks14 ) (/usr/local/texlive/2014/texmf-dist/tex/latex/xcolor/xcolor.sty Package: xcolor 2007/01/21 v2.11 LaTeX color extensions (UK) (/usr/local/texlive/2014/texmf-dist/tex/latex/latexconfig/color.cfg File: color.cfg 2007/01/18 v1.5 color configuration of teTeX/TeXLive ) Package xcolor Info: Driver file: pdftex.def on input line 225. (/usr/local/texlive/2014/texmf-dist/tex/latex/pdftex-def/pdftex.def File: pdftex.def 2011/05/27 v0.06d Graphics/color for pdfTeX (/usr/local/texlive/2014/texmf-dist/tex/generic/oberdiek/infwarerr.sty Package: infwarerr 2010/04/08 v1.3 Providing info/warning/error messages (HO) ) (/usr/local/texlive/2014/texmf-dist/tex/generic/oberdiek/ltxcmds.sty Package: ltxcmds 2011/11/09 v1.22 LaTeX kernel commands for general use (HO) ) \Gread@gobject=\count87 ) Package xcolor Info: Model `cmy' substituted by `cmy0' on input line 1337. Package xcolor Info: Model `hsb' substituted by `rgb' on input line 1341. Package xcolor Info: Model `RGB' extended on input line 1353. Package xcolor Info: Model `HTML' substituted by `rgb' on input line 1355. Package xcolor Info: Model `Hsb' substituted by `hsb' on input line 1356. Package xcolor Info: Model `tHsb' substituted by `hsb' on input line 1357. Package xcolor Info: Model `HSB' substituted by `hsb' on input line 1358. Package xcolor Info: Model `Gray' substituted by `gray' on input line 1359. Package xcolor Info: Model `wave' substituted by `hsb' on input line 1360. ) (/usr/local/texlive/2014/texmf-dist/tex/latex/lastpage/lastpage.sty Package: lastpage 2013/01/28 v1.2l Refers to last page's name (HMM; JPG) ) \c@thanks=\count88 \bmcfloat@box=\box26 \c@author=\count89 \c@address=\count90 \sv@mathsurround=\dimen104 \fm@box=\box27 \c@addressref=\count91 \thanks@box=\box28 \abstract@box=\box29 \authors@list=\toks15 \keywords@list=\toks16 ) (/usr/local/texlive/2014/texmf-dist/tex/latex/hyperref/hyperref.sty Package: hyperref 2012/11/06 v6.83m Hypertext links for LaTeX (/usr/local/texlive/2014/texmf-dist/tex/generic/oberdiek/hobsub-hyperref.sty Package: hobsub-hyperref 2012/05/28 v1.13 Bundle oberdiek, subset hyperref (HO) (/usr/local/texlive/2014/texmf-dist/tex/generic/oberdiek/hobsub-generic.sty Package: hobsub-generic 2012/05/28 v1.13 Bundle oberdiek, subset generic (HO) Package: hobsub 2012/05/28 v1.13 Construct package bundles (HO) Package hobsub Info: Skipping package `infwarerr' (already loaded). Package hobsub Info: Skipping package `ltxcmds' (already loaded). Package: ifluatex 2010/03/01 v1.3 Provides the ifluatex switch (HO) Package ifluatex Info: LuaTeX not detected. Package: ifvtex 2010/03/01 v1.5 Detect VTeX and its facilities (HO) Package ifvtex Info: VTeX not detected. Package: intcalc 2007/09/27 v1.1 Expandable calculations with integers (HO) Package: ifpdf 2011/01/30 v2.3 Provides the ifpdf switch (HO) Package ifpdf Info: pdfTeX in PDF mode is detected. Package: etexcmds 2011/02/16 v1.5 Avoid name clashes with e-TeX commands (HO) Package etexcmds Info: Could not find \expanded. (etexcmds) That can mean that you are not using pdfTeX 1.50 or (etexcmds) that some package has redefined \expanded. (etexcmds) In the latter case, load this package earlier. Package: kvsetkeys 2012/04/25 v1.16 Key value parser (HO) Package: kvdefinekeys 2011/04/07 v1.3 Define keys (HO) Package: pdftexcmds 2011/11/29 v0.20 Utility functions of pdfTeX for LuaTeX (HO ) Package pdftexcmds Info: LuaTeX not detected. Package pdftexcmds Info: \pdf@primitive is available. Package pdftexcmds Info: \pdf@ifprimitive is available. Package pdftexcmds Info: \pdfdraftmode found. Package: pdfescape 2011/11/25 v1.13 Implements pdfTeX's escape features (HO) Package: bigintcalc 2012/04/08 v1.3 Expandable calculations on big integers (HO ) Package: bitset 2011/01/30 v1.1 Handle bit-vector datatype (HO) Package: uniquecounter 2011/01/30 v1.2 Provide unlimited unique counter (HO) ) Package hobsub Info: Skipping package `hobsub' (already loaded). Package: letltxmacro 2010/09/02 v1.4 Let assignment for LaTeX macros (HO) Package: hopatch 2012/05/28 v1.2 Wrapper for package hooks (HO) Package: xcolor-patch 2011/01/30 xcolor patch Package: atveryend 2011/06/30 v1.8 Hooks at the very end of document (HO) Package atveryend Info: \enddocument detected (standard20110627). Package: atbegshi 2011/10/05 v1.16 At begin shipout hook (HO) Package: refcount 2011/10/16 v3.4 Data extraction from label references (HO) Package: hycolor 2011/01/30 v1.7 Color options for hyperref/bookmark (HO) ) (/usr/local/texlive/2014/texmf-dist/tex/generic/ifxetex/ifxetex.sty Package: ifxetex 2010/09/12 v0.6 Provides ifxetex conditional ) (/usr/local/texlive/2014/texmf-dist/tex/latex/oberdiek/auxhook.sty Package: auxhook 2011/03/04 v1.3 Hooks for auxiliary files (HO) ) (/usr/local/texlive/2014/texmf-dist/tex/latex/oberdiek/kvoptions.sty Package: kvoptions 2011/06/30 v3.11 Key value format for package options (HO) ) \@linkdim=\dimen105 \Hy@linkcounter=\count92 \Hy@pagecounter=\count93 (/usr/local/texlive/2014/texmf-dist/tex/latex/hyperref/pd1enc.def File: pd1enc.def 2012/11/06 v6.83m Hyperref: PDFDocEncoding definition (HO) ) \Hy@SavedSpaceFactor=\count94 (/usr/local/texlive/2014/texmf-dist/tex/latex/latexconfig/hyperref.cfg File: hyperref.cfg 2002/06/06 v1.2 hyperref configuration of TeXLive ) Package hyperref Info: Option `colorlinks' set `true' on input line 4319. Package hyperref Warning: Option `pagecolor' is not available anymore. Package hyperref Info: Hyper figures OFF on input line 4443. Package hyperref Info: Link nesting OFF on input line 4448. Package hyperref Info: Hyper index ON on input line 4451. Package hyperref Info: Plain pages OFF on input line 4458. Package hyperref Info: Backreferencing OFF on input line 4463. Package hyperref Info: Implicit mode ON; LaTeX internals redefined. Package hyperref Info: Bookmarks ON on input line 4688. \c@Hy@tempcnt=\count95 (/usr/local/texlive/2014/texmf-dist/tex/latex/url/url.sty \Urlmuskip=\muskip10 Package: url 2013/09/16 ver 3.4 Verb mode for urls, etc. ) LaTeX Info: Redefining \url on input line 5041. \XeTeXLinkMargin=\dimen106 \Fld@menulength=\count96 \Field@Width=\dimen107 \Fld@charsize=\dimen108 Package hyperref Info: Hyper figures OFF on input line 6295. Package hyperref Info: Link nesting OFF on input line 6300. Package hyperref Info: Hyper index ON on input line 6303. Package hyperref Info: backreferencing OFF on input line 6310. Package hyperref Info: Link coloring ON on input line 6313. Package hyperref Info: Link coloring with OCG OFF on input line 6320. Package hyperref Info: PDF/A mode OFF on input line 6325. LaTeX Info: Redefining \ref on input line 6365. LaTeX Info: Redefining \pageref on input line 6369. \Hy@abspage=\count97 \c@Item=\count98 \c@Hfootnote=\count99 ) Package hyperref Message: Driver (autodetected): hpdftex. (/usr/local/texlive/2014/texmf-dist/tex/latex/hyperref/hpdftex.def File: hpdftex.def 2012/11/06 v6.83m Hyperref driver for pdfTeX \Fld@listcount=\count100 \c@bookmark@seq@number=\count101 (/usr/local/texlive/2014/texmf-dist/tex/latex/oberdiek/rerunfilecheck.sty Package: rerunfilecheck 2011/04/15 v1.7 Rerun checks for auxiliary files (HO) Package uniquecounter Info: New unique counter `rerunfilecheck' on input line 2 82. ) \Hy@SectionHShift=\skip43 ) (/usr/local/texlive/2014/texmf-dist/tex/latex/base/inputenc.sty Package: inputenc 2014/04/30 v1.2b Input encoding file \inpenc@prehook=\toks17 \inpenc@posthook=\toks18 (/usr/local/texlive/2014/texmf-dist/tex/latex/base/utf8.def File: utf8.def 2008/04/05 v1.1m UTF-8 support for inputenc Now handling font encoding OML ... ... no UTF-8 mapping file for font encoding OML Now handling font encoding T1 ... ... processing UTF-8 mapping file for font encoding T1 (/usr/local/texlive/2014/texmf-dist/tex/latex/base/t1enc.dfu File: t1enc.dfu 2008/04/05 v1.1m UTF-8 support for inputenc defining Unicode char U+00A1 (decimal 161) defining Unicode char U+00A3 (decimal 163) defining Unicode char U+00AB (decimal 171) defining Unicode char U+00BB (decimal 187) defining Unicode char U+00BF (decimal 191) defining Unicode char U+00C0 (decimal 192) defining Unicode char U+00C1 (decimal 193) defining Unicode char U+00C2 (decimal 194) defining Unicode char U+00C3 (decimal 195) defining Unicode char U+00C4 (decimal 196) defining Unicode char U+00C5 (decimal 197) defining Unicode char U+00C6 (decimal 198) defining Unicode char U+00C7 (decimal 199) defining Unicode char U+00C8 (decimal 200) defining Unicode char U+00C9 (decimal 201) defining Unicode char U+00CA (decimal 202) defining Unicode char U+00CB (decimal 203) defining Unicode char U+00CC (decimal 204) defining Unicode char U+00CD (decimal 205) defining Unicode char U+00CE (decimal 206) defining Unicode char U+00CF (decimal 207) defining Unicode char U+00D0 (decimal 208) defining Unicode char U+00D1 (decimal 209) defining Unicode char U+00D2 (decimal 210) defining Unicode char U+00D3 (decimal 211) defining Unicode char U+00D4 (decimal 212) defining Unicode char U+00D5 (decimal 213) defining Unicode char U+00D6 (decimal 214) defining Unicode char U+00D8 (decimal 216) defining Unicode char U+00D9 (decimal 217) defining Unicode char U+00DA (decimal 218) defining Unicode char U+00DB (decimal 219) defining Unicode char U+00DC (decimal 220) defining Unicode char U+00DD (decimal 221) defining Unicode char U+00DE (decimal 222) defining Unicode char U+00DF (decimal 223) defining Unicode char U+00E0 (decimal 224) defining Unicode char U+00E1 (decimal 225) defining Unicode char U+00E2 (decimal 226) defining Unicode char U+00E3 (decimal 227) defining Unicode char U+00E4 (decimal 228) defining Unicode char U+00E5 (decimal 229) defining Unicode char U+00E6 (decimal 230) defining Unicode char U+00E7 (decimal 231) defining Unicode char U+00E8 (decimal 232) defining Unicode char U+00E9 (decimal 233) defining Unicode char U+00EA (decimal 234) defining Unicode char U+00EB (decimal 235) defining Unicode char U+00EC (decimal 236) defining Unicode char U+00ED (decimal 237) defining Unicode char U+00EE (decimal 238) defining Unicode char U+00EF (decimal 239) defining Unicode char U+00F0 (decimal 240) defining Unicode char U+00F1 (decimal 241) defining Unicode char U+00F2 (decimal 242) defining Unicode char U+00F3 (decimal 243) defining Unicode char U+00F4 (decimal 244) defining Unicode char U+00F5 (decimal 245) defining Unicode char U+00F6 (decimal 246) defining Unicode char U+00F8 (decimal 248) defining Unicode char U+00F9 (decimal 249) defining Unicode char U+00FA (decimal 250) defining Unicode char U+00FB (decimal 251) defining Unicode char U+00FC (decimal 252) defining Unicode char U+00FD (decimal 253) defining Unicode char U+00FE (decimal 254) defining Unicode char U+00FF (decimal 255) defining Unicode char U+0102 (decimal 258) defining Unicode char U+0103 (decimal 259) defining Unicode char U+0104 (decimal 260) defining Unicode char U+0105 (decimal 261) defining Unicode char U+0106 (decimal 262) defining Unicode char U+0107 (decimal 263) defining Unicode char U+010C (decimal 268) defining Unicode char U+010D (decimal 269) defining Unicode char U+010E (decimal 270) defining Unicode char U+010F (decimal 271) defining Unicode char U+0110 (decimal 272) defining Unicode char U+0111 (decimal 273) defining Unicode char U+0118 (decimal 280) defining Unicode char U+0119 (decimal 281) defining Unicode char U+011A (decimal 282) defining Unicode char U+011B (decimal 283) defining Unicode char U+011E (decimal 286) defining Unicode char U+011F (decimal 287) defining Unicode char U+0130 (decimal 304) defining Unicode char U+0131 (decimal 305) defining Unicode char U+0132 (decimal 306) defining Unicode char U+0133 (decimal 307) defining Unicode char U+0139 (decimal 313) defining Unicode char U+013A (decimal 314) defining Unicode char U+013D (decimal 317) defining Unicode char U+013E (decimal 318) defining Unicode char U+0141 (decimal 321) defining Unicode char U+0142 (decimal 322) defining Unicode char U+0143 (decimal 323) defining Unicode char U+0144 (decimal 324) defining Unicode char U+0147 (decimal 327) defining Unicode char U+0148 (decimal 328) defining Unicode char U+014A (decimal 330) defining Unicode char U+014B (decimal 331) defining Unicode char U+0150 (decimal 336) defining Unicode char U+0151 (decimal 337) defining Unicode char U+0152 (decimal 338) defining Unicode char U+0153 (decimal 339) defining Unicode char U+0154 (decimal 340) defining Unicode char U+0155 (decimal 341) defining Unicode char U+0158 (decimal 344) defining Unicode char U+0159 (decimal 345) defining Unicode char U+015A (decimal 346) defining Unicode char U+015B (decimal 347) defining Unicode char U+015E (decimal 350) defining Unicode char U+015F (decimal 351) defining Unicode char U+0160 (decimal 352) defining Unicode char U+0161 (decimal 353) defining Unicode char U+0162 (decimal 354) defining Unicode char U+0163 (decimal 355) defining Unicode char U+0164 (decimal 356) defining Unicode char U+0165 (decimal 357) defining Unicode char U+016E (decimal 366) defining Unicode char U+016F (decimal 367) defining Unicode char U+0170 (decimal 368) defining Unicode char U+0171 (decimal 369) defining Unicode char U+0178 (decimal 376) defining Unicode char U+0179 (decimal 377) defining Unicode char U+017A (decimal 378) defining Unicode char U+017B (decimal 379) defining Unicode char U+017C (decimal 380) defining Unicode char U+017D (decimal 381) defining Unicode char U+017E (decimal 382) defining Unicode char U+200C (decimal 8204) defining Unicode char U+2013 (decimal 8211) defining Unicode char U+2014 (decimal 8212) defining Unicode char U+2018 (decimal 8216) defining Unicode char U+2019 (decimal 8217) defining Unicode char U+201A (decimal 8218) defining Unicode char U+201C (decimal 8220) defining Unicode char U+201D (decimal 8221) defining Unicode char U+201E (decimal 8222) defining Unicode char U+2030 (decimal 8240) defining Unicode char U+2031 (decimal 8241) defining Unicode char U+2039 (decimal 8249) defining Unicode char U+203A (decimal 8250) defining Unicode char U+2423 (decimal 9251) ) Now handling font encoding OT1 ... ... processing UTF-8 mapping file for font encoding OT1 (/usr/local/texlive/2014/texmf-dist/tex/latex/base/ot1enc.dfu File: ot1enc.dfu 2008/04/05 v1.1m UTF-8 support for inputenc defining Unicode char U+00A1 (decimal 161) defining Unicode char U+00A3 (decimal 163) defining Unicode char U+00B8 (decimal 184) defining Unicode char U+00BF (decimal 191) defining Unicode char U+00C5 (decimal 197) defining Unicode char U+00C6 (decimal 198) defining Unicode char U+00D8 (decimal 216) defining Unicode char U+00DF (decimal 223) defining Unicode char U+00E6 (decimal 230) defining Unicode char U+00EC (decimal 236) defining Unicode char U+00ED (decimal 237) defining Unicode char U+00EE (decimal 238) defining Unicode char U+00EF (decimal 239) defining Unicode char U+00F8 (decimal 248) defining Unicode char U+0131 (decimal 305) defining Unicode char U+0141 (decimal 321) defining Unicode char U+0142 (decimal 322) defining Unicode char U+0152 (decimal 338) defining Unicode char U+0153 (decimal 339) defining Unicode char U+2013 (decimal 8211) defining Unicode char U+2014 (decimal 8212) defining Unicode char U+2018 (decimal 8216) defining Unicode char U+2019 (decimal 8217) defining Unicode char U+201C (decimal 8220) defining Unicode char U+201D (decimal 8221) ) Now handling font encoding OMS ... ... processing UTF-8 mapping file for font encoding OMS (/usr/local/texlive/2014/texmf-dist/tex/latex/base/omsenc.dfu File: omsenc.dfu 2008/04/05 v1.1m UTF-8 support for inputenc defining Unicode char U+00A7 (decimal 167) defining Unicode char U+00B6 (decimal 182) defining Unicode char U+00B7 (decimal 183) defining Unicode char U+2020 (decimal 8224) defining Unicode char U+2021 (decimal 8225) defining Unicode char U+2022 (decimal 8226) ) Now handling font encoding OMX ... ... no UTF-8 mapping file for font encoding OMX Now handling font encoding U ... ... no UTF-8 mapping file for font encoding U Now handling font encoding PD1 ... ... no UTF-8 mapping file for font encoding PD1 defining Unicode char U+00A9 (decimal 169) defining Unicode char U+00AA (decimal 170) defining Unicode char U+00AE (decimal 174) defining Unicode char U+00BA (decimal 186) defining Unicode char U+02C6 (decimal 710) defining Unicode char U+02DC (decimal 732) defining Unicode char U+200C (decimal 8204) defining Unicode char U+2026 (decimal 8230) defining Unicode char U+2122 (decimal 8482) defining Unicode char U+2423 (decimal 9251) )) (./bmc_article.aux) \openout1 = `bmc_article.aux'. LaTeX Font Info: Checking defaults for OML/cmm/m/it on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for T1/cmr/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for OT1/cmr/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for OMS/cmsy/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for OMX/cmex/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for U/cmr/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. LaTeX Font Info: Checking defaults for PD1/pdf/m/n on input line 86. LaTeX Font Info: ... okay on input line 86. (/usr/local/texlive/2014/texmf-dist/tex/context/base/supp-pdf.mkii [Loading MPS to PDF converter (version 2006.09.02).] \scratchcounter=\count102 \scratchdimen=\dimen109 \scratchbox=\box30 \nofMPsegments=\count103 \nofMParguments=\count104 \everyMPshowfont=\toks19 \MPscratchCnt=\count105 \MPscratchDim=\dimen110 \MPnumerator=\count106 \makeMPintoPDFobject=\count107 \everyMPtoPDFconversion=\toks20 ) Package lastpage Info: Please have a look at the pageslts package at (lastpage) http://www.ctan.org/tex-archive/ (lastpage) macros/latex/contrib/pageslts/ (lastpage) or (lastpage) http://www.ctan.org/tex-archive/ (lastpage) install/macros/latex/contrib/pageslts.tds.zip (lastpage) ! on input line 86. \AtBeginShipoutBox=\box31 Package hyperref Info: Link coloring ON on input line 86. (/usr/local/texlive/2014/texmf-dist/tex/latex/hyperref/nameref.sty Package: nameref 2012/10/27 v2.43 Cross-referencing by name of section (/usr/local/texlive/2014/texmf-dist/tex/generic/oberdiek/gettitlestring.sty Package: gettitlestring 2010/12/03 v1.4 Cleanup title references (HO) ) \c@section@level=\count108 ) LaTeX Info: Redefining \ref on input line 86. LaTeX Info: Redefining \pageref on input line 86. LaTeX Info: Redefining \nameref on input line 86. (./bmc_article.out) (./bmc_article.out) \@outlinefile=\write3 \openout3 = `bmc_article.out'. LaTeX Font Warning: Font shape `OT1/cmss/bx/n' in size <13> not available (Font) size <12> substituted on input line 92. LaTeX Font Warning: Font shape `OT1/cmss/m/n' in size <24> not available (Font) size <24.88> substituted on input line 100. LaTeX Font Info: Calculating math sizes for size <11> on input line 119. LaTeX Font Warning: Font shape `OT1/cmr/m/n' in size <5.5> not available (Font) size <5> substituted on input line 119. LaTeX Font Warning: Font shape `OML/cmm/m/it' in size <5.5> not available (Font) size <5> substituted on input line 119. LaTeX Font Warning: Font shape `OMS/cmsy/m/n' in size <5.5> not available (Font) size <5> substituted on input line 119. LaTeX Font Info: External font `cmex10' loaded for size (Font) <11> on input line 119. LaTeX Font Info: External font `cmex10' loaded for size (Font) <7.69997> on input line 119. LaTeX Font Info: External font `cmex10' loaded for size (Font) <5.5> on input line 119. \address@aff1=\toks21 \address@aff2=\toks22 LaTeX Font Info: External font `cmex10' loaded for size (Font) <7> on input line 166. LaTeX Font Info: External font `cmex10' loaded for size (Font) <5> on input line 166. LaTeX Font Warning: Font shape `OT1/cmss/m/it' in size <8> not available (Font) Font shape `OT1/cmss/m/sl' tried instead on input line 271. Overfull \hbox (1.0pt too wide) has occurred while \output is active [] [] [1{/usr/local/texlive/2014/texmf-var/fonts/map/pdftex/updmap/pdftex.map} ] [2] Overfull \hbox (64.24629pt too wide) in paragraph at lines 304--304 []\OT1/cmtt/m/n/10 my $seq_out = Bio::SeqIO->new('-file' => ">$out_file_temp",' -format' => 'fasta');[] [] Overfull \hbox (27.49661pt too wide) in paragraph at lines 304--304 []\OT1/cmtt/m/n/10 my $seq_obj = $db->get_Seq_by_id('seq'); # get FASTA records using headers[] [] Overfull \hbox (16.9967pt too wide) in paragraph at lines 304--304 []\OT1/cmtt/m/n/10 #(where header = first 'word' so really header whitespace sh ould also be[] [] Overfull \hbox (85.24611pt too wide) in paragraph at lines 322--322 []\OT1/cmtt/m/n/10 ACTGTGTGCAATCGCTGNNNNCTCTCATCGGATCTTGCAATCGCTNNNCTCTCATCGGAT TGCAATCGCTNNNCTtcatcCGGAT[] [] Overfull \hbox (85.24611pt too wide) in paragraph at lines 322--322 []\OT1/cmtt/m/n/10 CGCTGNNNNCTGTGTGCAATCGCTGNNNNCTCCTGATCGCTGNNNNCTGTGTGCAATCGC TGNNNNCTCCTGCAATCGCTGNNNN[] [] Overfull \hbox (27.49661pt too wide) in paragraph at lines 329--329 []\OT1/cmtt/m/n/10 MSG: Each line of the fasta entry must be the same length ex cept the last.[] [] Overfull \hbox (32.74657pt too wide) in paragraph at lines 345--345 []\OT1/cmtt/m/n/10 ATTATTATATATATATTCTCTCTGGGCTCGCGTCTCGCTATTTATATATATATATATATT GCGCTCTCGTCTCCT[] [] [3] [4] [5] Overfull \hbox (1.24684pt too wide) in paragraph at lines 395--395 []\OT1/cmtt/m/n/10 filename="$(python fasta_o_matic.py -f NC_010473_mock_scaffo lds.fna \[] [] Overfull \hbox (74.7462pt too wide) in paragraph at lines 427--427 []\OT1/cmtt/m/n/10 >NW_000000000.0 Vicugna pacos isolate Carlotta (AHFN-0088) F AKE genomic scaffold, \[] [] [6] Overfull \hbox (35.74657pt too wide) in paragraph at lines 435--436 [][]$\OT1/cmtt/m/n/10 https : / / github . com / i5K-[]KINBRE-[]script-[]share / read-[]cleaning-[]format-[]conversion / [] (./bmc_article.bbl [7]) LaTeX Font Info: External font `cmex10' loaded for size (Font) <8> on input line 531. LaTeX Font Info: External font `cmex10' loaded for size (Font) <6> on input line 531. AED: lastpage setting LastPage [8] Package atveryend Info: Empty hook `BeforeClearDocument' on input line 581. Package atveryend Info: Empty hook `AfterLastShipout' on input line 581. (./bmc_article.aux) Package atveryend Info: Executing hook `AtVeryEndDocument' on input line 581. Package atveryend Info: Executing hook `AtEndAfterFileList' on input line 581. Package rerunfilecheck Info: File `bmc_article.out' has not changed. (rerunfilecheck) Checksum: EDF8A35878083FE9768DD6496A091B88;962. LaTeX Font Warning: Size substitutions with differences (Font) up to 1.0pt have occurred. Package atveryend Info: Empty hook `AtVeryVeryEnd' on input line 581. ) Here is how much of TeX's memory you used: 6125 strings out of 493117 87212 string characters out of 6135433 181667 words of memory out of 5000000 9507 multiletter control sequences out of 15000+600000 11019 words of font info for 39 fonts, out of 8000000 for 9000 1141 hyphenation exceptions out of 8191 30i,9n,39p,1056b,425s stack positions out of 5000i,500n,10000p,200000b,80000s Output written on bmc_article.pdf (8 pages, 171133 bytes). PDF statistics: 219 PDF objects out of 1000 (max. 8388607) 196 compressed objects within 2 object streams 52 named destinations out of 1000 (max. 500000) 113 words of extra memory for PDF output out of 10000 (max. 10000000)