Determination of Zn 2+ concentrations on Zrt1 and Fet4 expression level in S. cerevisiae
EZ-10 Spin Column Fungal RNA Miniprep Kit (Bio Basic, Canada) was applied according to the manufacturer’s structure, to isolate total RNA from zinc absorbed yeasts. Then, cDNA was immediately prepared with the AccuPower RocketScript RT PreMix (Bioneer, Korea). Subsequently, relative quantification of Zrt1 and Fet4 expression was determined using quantitative real time PCR (qRT-PCR) with RealQ Plus 2x Master Mix Green (Ampliqon Co, Denmark). The qRT-PCR reactions were prepared in a total volume of 20 µl and cycling conditions of 95°C (15 min), followed by 95°C (20 s, 40 cycles), and 60°C (1 min) was performed. We used same designed primers of Zrt1 and Fet4 genes which had been used in yeasts isolation step; also F: 5’ AAACGGCTACCACATCCAAG 3’ and R: 5’ CCCATCCCAAGGTTCAACTA 3’ pairs were applied for amplification of 18SrRNA gene as internal control. Finally, melting curve analysis was considered to validate the specificity of the expected PCR product as well as nonoccurrence of primer‐dimer formation. All reactions were carried out in triplicate and the results were analyzed by threshold cycle (Ct) values.