Examination of Zrt1 and Fet4 genes in isolated yeasts and
identification of yeast’s strain
The total DNA was extracted from cells which were directly collected
from yeast pellets, with DNA extraction kit (CinnaGen, Iran) according
to manufacturer’s protocol. The concentrations of all DNA samples were
quantified with NanoDropTM and DNAs were used in the subsequent PCR
procedures:
Examination of Zrt1 and Fet4 genes. To isolation of samples which
express Zrt1 and Fet4 genes, PCR reaction was performed using primers ofF: 5′ AAATGCACTAGAACATGGCG 3′ and R: 5′
TTCATGACTATTTAAATGCCTT 3′ for Zrt1 gene as well as F: 5′
GGAGAACTGCCTGTGGAAAA 3′ and R: 5′ GAGGGCCATGAAGGTATCAA 3′ for
Fet4 gene, under following program: 95°C (3 min), 95°C (30 sec), 59°C
(30 sec, 35 cycles), 72°C (1 min), and final extension step at 72°C (10
min). Then PCR products were electrophoresed and results were observed
on 1.5% agarose gel.
Identification of yeast’s strain . After isolating samples which
express Zrt1 and Fet4 genes, the identification of yeast strain was
performed using a common PCR methods. ITS1: 5’
TCCGTAGGTGAACCTTGCGG 3’ and ITS4: 5’ TCCTCCGCTTATTGATATGC 3’primers were used in PCR reaction with following program: 94 °C (1 min,
35 cycles), 55.5 °C (2 min), 72 °C (2 min), and final extension step at
72 °C (10 min). Then PCR products were electrophoresed and results were
observed on 1.5% agarose gel. The samples which showed the related
fragments were verified by sequencing (Bioneer Co, Korea).